Gene putatively regulated by attenuation
Gene: CC0485     Organism: C_crescentus     GI: 16124740     GOG: [J] COG1825 Ribosomal protein L25 (general stress protein Ctc)     Genome position: 507004     Function: ribosomal 5S rRNA E-loop binding protein Ctc/L25/TL5

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -19.1 kcal/mol    
Antiterminator: Size=28 nt.     Delta G= -10.5 kcal/mol    
Anti-antiterminator:   Size=49 nt.     Delta G= -13.2 kcal/mol    

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined

GCGTCATCAAAGCCGCCGGCGCTACGGTGCCGCCCGAACCGCCGCGCGTCCTGCCGGT
CAAGGAATCGATCGCGACCAGGGGCGCGGGCTCCAACTCGCGCAAGGCCAAGACCCCC
GCCAAGAAGCCGGCCAAGAAGGGCTGAtctttcgcccattccatcacgaggggccgggcgttgcgtcgcctggccctttt
gtgtatgtagcgcgaccccaaaacgaccgggcgagcgtggcgatccagccataggcgctctggtcccagaagagagcatccggctctctagaaagaacgc
caccATG

    CC0485            -


 AA                     
G  G                    
A  C                    
A  C                    
 CG                     
 CG                     
 GC                     
|  C                    
|  A                    
|  A                    
|  G                    
|  A                    
C  A                    
 CG                     
 CG         a           
 CG       c  c          
|  C      t  g       gc 
|  T      a  a      t  g
|  G       cg       t  t
C  A       cg        gc 
 At        tg        cg 
 Gc        tg        gc 
 At       |  c       gc 
 At       a  c       gt 
|  t       cg        cg 
C  c       cg        cg 
 Cg        cg        gc 
 Gc        gc        gc 
 Gc        cg        gc 
                        ttttgtgtatgtagcgcgaccccaaaacgaccgggcgagcgtggcgatccagccataggcgctctggtcccagaagagagcatccggctctctagaaagaacgccaccATG

 Predicted attenuators in orthologous genes of the [J] COG1825 Ribosomal protein L25 (general stress protein Ctc) ... can be seen here
    ..................................................................................................................