Gene putatively regulated by attenuation
Gene: glr     Organism: S_pyogenes_MGAS315     GI: 21909798     GOG: [M] COG0796 Glutamate racemase     Genome position: 302972     Function: putative glutamate racemase

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -10.9 kcal/mol    
Antiterminator:    Distance from promoter:59 nt. Size=37 nt.     Delta G= -8.5 kcal/mol    
Anti-antiterminator:    Distance from promoter:26 nt.    Size=45 nt.     Delta G= -7.0 kcal/mol    

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtta-gatagt. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined

ttgttataggggaaacctttgtgatagttagaagtgaacagtctttgatctcaatgttcagtagcacttgtcttatcagttagatttgtcaactgttcag
ggtttaaaaagaaactcagttggctatttccaactgagtttttcatatcgtcagtaaggaagtaaagataATG

    -            glr


 ca                     
t  g                    
a  t                    
t  t       aa           
 ta       a  a          
 cg       a  g          
 ta        ta           
 gt        ta           
t  t       ta           
t  |       gc           
c  |      g  t          
 at       g  |          
 cg       a  |       at 
 gt       c  |      t  t
|  c      t  |      c  t
a  a      t  |       g
 ta        gc        g
 gc        ta        t
 at        cg        t
 cg        at        g
t  t       at        a
t  t       cg        c
 gc        tg        t
 ta        gc        c
                        tttttcatatcgtcagtaaggaagtaaagataATG

Predicted attenuators in orthologous genes of the [M] COG0796 Glutamate racemase ... can be seen here
    ..................................................................................................................